TTA served as a negative control in this assay (Figure 4B, number 11). A semiquantitative MRT67307 order RT-PCR experiment further showed that these mutations at codon position -23 did not affect the stability of the mRNAs derived from these constructs (Figure 4D). Initiation activities SB-715992 determined using lacZ as a reporter To verify whether the Western blot assays shown in Figure 4 faithfully reflect the initiation activities of the various non-AUG initiator codons, we next employed a different

assay using lacZ as a reporter [21]. The lexA portion of the GRS1-lexA fusion constructs was replaced by an initiator mutant of lacZ, yielding various GRS1-lacZ fusion constructs (schematized in Figure 5). The β-gal activities derived from these fusion constructs were then determined. As shown in Figure 5, ATG, TTG, ACG, and ATC had relative initiation activities of 1.00: 0.28: 0.12: 0.07 (Figure 5, numbers 1~4), ratios which are very close to those determined by Western blotting (Figure 4). In contrast, no discernible β-gal activity was found for the TTA construct (Figure 5, number 5). Figure 5 Comparison of the efficiencies of various

non-AUG initiator codons using lacZ as a reporter. Efficiencies of translation using various initiator codons were determined by measuring the relative β-gal activities in extracts prepared from the transformants. The data were obtained from three independent experiments, and the relative β-gal activities are presented as the mean ± 2 click here × S.D., with the β-gal activity of the construct carrying an ATG initiator codon as a reference. Discussion Despite significant differences in contextual preferences and sensitivities between non-AUG initiators of yeast and higher eukaryotes [21, 27], our results show that except for AAG and AGG, all non-AUG codons that differ from AUG by a single nucleotide can PAK5 act as initiator codons

in yeast (Figure 2). An obvious advantage of beginning translation at non-AUG initiator codons is that these codons significantly vary in their initiation activity and are subject to regulation by the sequence context. As a consequence, they are more suitable than AUG to serve as alternative translation initiation sites to modulate the relative levels of two (or more) distinct protein isoforms [21]. While efficiencies of translation initiation from non-AUG codons are much lower (~10%~50%) than that from an AUG triplet positioned at the same site, the AlaRS or GlyRS protein initiated from these non-AUG codons was sufficient to rescue the growth defect of their respective knockout strains on YPG plates (Figs. 2, 4). Even though protein levels of the mitochondrial form of AlaRS can be drastically reduced, complementation functions at a fairly high efficiency. However, it should be noted that translation initiation from codons other than the often-seen non-AUG initiator codons does occur in nature.

, MI., Italy). Polymerase chain reaction (PCR) amplification and denaturing gel electrophoresis (DGGE) analysis DNA isolated from duodenal biopsy and faecal samples was subsequently used as the template in PCR assays applying eubacterial universal and group-specific 16S rRNA gene primer sets. All primers used in this study are listed in Table 1. The forward or the reverse primer of each set was extended with a 40 mer GC-clamp at the 5′ end to separate the corresponding

PCR products in the gradient gel [46]. The specificity of each primer pair was experimentally tested by using DNA extracted from the following bacteria species: Bacteroides fragilis DSM 2151, Bifidobacterium bifidum DSM 20082, L. plantarum selleck products ATCC 14917, Weissella confusa DSM2196, P. pentosoceus DSM 20336, Leuconostoc lactis DSM 20202, E. durans DSM 20633, E. faecium DSM 2918, Clostridium coccoides

DSM 935, Staphylococcus aureus DSM 20714, Enterobacter aerogenes DSM 30053, Escherichia coli DSM 30083 and TSA HDAC nmr Yersinia enterocolitica DSM 4780. Each primer set gave positive PCR results for the corresponding target bacteria and did not cross-react with any of the non target microorganisms. Each PCR mixture contained 80 – 100 ng and 40 ng of template DNA extracted from bioptic materials and faecal samples PXD101 mouse respectively, 50 pmol of each primer, 10 nmol of each 2′-deoxynucleoside 5′-triphosphate (dNTP), 3 U of Taq DNA polymerase (EuroTaq, EuroClone, Italy) and 2.5 mM MgCl2 in a buffered final volume of 50 μl. The following Tenofovir mw PCR core program was used for the first three primer pairs listed in Table 1: initial denaturation

at 95°C for 3 min; 30 cycles of denaturation at 95°C for 20 s, annealing at primer-specific temperature for 45 s and extension at 72°C for 1 min; and final extension at 72°C for 7 min. DNA extracted from duodenal biopsies was amplified by two additional set of primers targeting Bifidobacterium group and the PCR thermocycling program used for both Bif164-f/Bif662-GC-r and Bif164-GC-f/Bif662-r was: 94°C for 5 min; 35 cycles of 94°C for 30 s, 62°C for 20 s, and 68°C for 40 s; and 68°C for 7 min [47]. PCR amplification products were checked by electrophoresis in 1.5% agarose Gel Red 10,000X stained gels and stored at -20°C. Amplicons were separated by DGGE, using the Bio-Rad DCode™ Universal Mutation detection System (Bio-Rad Laboratories, Hercules, CA, USA). Different linear denaturing gradients of urea and formamide were applied depending on the amplified target sequence and type of samples (Table 1). The denaturing gradient conditions proposed by Vanhoutte et al. [43] were modified as described below.

Recent literature has introduced the emerging technology of molecular AST [16–19] in which quantitative PCR is used to monitor the growth of bacterial cultures in the presence of antibiotic agents. They are based on the amplification of the rpoB gene; the 16S ribosomal locus universally found in the bacterial genome. The technology is based on the premise that the growth kinetics of bacteria in culture can be monitored by measuring the increasing amounts genomic DNA. In this fashion, MICs may be determined on the same day as the initial inoculation rather than an overnight incubation. mTOR inhibitor The kinetics of increasing PCR signal from a growing culture in the

presence of an antibiotic can be used to determine selleck whether a pathogen is resistant or susceptible to the agent. Furthermore, one group reports a workflow in

which molecular AST can be performed on bacteria harvested directly from blood culture using serum separation tubes, identifying the pathogen with species specific qPCR probes, and producing a molecular AST result in a single day [20]. Our group has previously reported a novel methodology termed Enzyme Template Generation and Amplification (ETGA) that enables universal, sensitive and quantitative measurement of bacterial proliferation via measurement of endogenous DNA polymerase activity [21]. In this report, we demonstrate that molecular AST and MIC Tucidinostat in vitro determination can be performed via ETGA-mediated monitoring of DNA polymerase activity. We compare the functionality of ETGA AST to

PCR-based molecular AST using gene-specific qPCR assays (gsPCR) against either S. aureus or E. coli. We also show that ETGA AST can be used to determine MICs from bacteria harvested directly Tangeritin from spiked blood cultures. Methods Bacterial strains, cultivation, and antibiotics tested The following strains were used in this study: Escherichia coli ATCC 25922, methicillin susceptible Staphylococcus aureus ATCC 29213, and methicillin resistant Staphylococcus aureus NRS241. All strains were propagated on Brain-Heart Infusion Agar (Teknova, Hollister, CA). The S. aureus strains, both methicillin resistant and susceptible, were tested for susceptibility against oxacillin and vancomycin (Sigma Aldrich, St. Louis, MO). The E. coli strain was tested for susceptibility against ciprofloxacin and tetracycline (Sigma Aldrich, St. Louis, MO). Macrodilution broth method for the determination of antimicrobial susceptibility The macrobroth dilution method and the interpretive standards for determining the antimicrobial susceptibility of a microorganism to an antimicrobial agent are published by the Clinical and Laboratory Standards Institute [6, 8].

The DNA was washed with 70% ethanol and centrifuged for 5 min at 10,500g. The pellet was dried for 1 h in a biological hood and suspended in

100 μL TE (10 mM Tris HCl pH 8.0, 0.1 mM EDTA) or sterile ultra-purified water. DNA extraction from S. sclerotiorum was ALK mutation performed by fast extraction from mycelial plugs using NaOH as described by Levy and colleagues [12]. To verify transformation, we performed PCR analyses on DNA extracted from putative transformants using Hygr (Hyg F and Hyg R) and Phleor (Phleo F and Phleo R) cassette primers (Table 1). For verification of knockout by homologous recombination, a 480-bp fragment was amplified with primer bR-gen 5′F, which is located in the 5′ upstream genomic region of the bR gene and is not present in the 5′ fragment of the bR construct, and primer bR-Hyg 5′R from the Hyg cassette; a 590-bp selleck screening library fragment was amplified by primer bR-gen 3′F which is located in the 3′ downstream genomic region of the bR gene and is not present in the 3′ fragment of the bR construct, and primer bR-Hyg 3′R which is located at the 3′ end of the Hyg cassette. Table 1 Primer details for the PCR analysis of transformants No. Name Sequence click here Fragment size (bp) 1 Hyg F CGACGTTACTGGTTCCCGGT   2 Hyg R GCGGGCACGTTAACTGAT 550 3 bR-gen 5′F ACAAGACCTCTCGCCTTT

  4 bR-Hyg 5′R AGGTCGGAGACGCTGTCGAA 480 5 bR-gen 3′F ATGCAGCTTGGGCTGTTCAG   6 bR-Hyg 3′R CGACTCCCAACTCGACTA 590 7 Phleo F GGGGACAAGTTTGTACAAAAAAGCAGGCT   8 Phleo R GGGGACCACTTTGTACAAGAAAGCTGGGT

1020 All PCR analyses were performed in 0.2-mL tubes containing PCR reagent (ReddyMix®, Thermo Fisher Scientific Inc., Surrey, UK) with 5 pmol of primers, 12.5 to 25 ng 3-oxoacyl-(acyl-carrier-protein) reductase template DNA and sterile purified water to a final volume of 20 μL. PCR was carried out on a T-gradient PCR instrument (Biometra, Goettingen, Germany). Activation of the enzyme was carried out at 95°C for 5 min followed by denaturation for 45 s at 94°C, annealing at 62°C for 45 s, elongation at 70°C for 45 s for 30 to 40 cycles, and 10 min of elongation at 70°C. PCR products were analyzed on a 1 to 2% agarose gel according to their size and stained with ‘Safeview’ (G108 SafeView™ Nucleic Acid Stain, Applied Biological Materials Inc., Richmond, Canada). Results Protoplast-mediated transformation by electroporation Three different DNA constructs were used for transformation of B. cinerea (Figure 1). The bR knockout construct (Figure 1a) was based on a modified Gateway vector according to Shafran and colleagues [13] (see Methods). This construct was used with all transformation methods. Protoplasts generated from germinating conidia or broken hyphae were used for electroporation experiments: the few colonies that slowly recovered from electroporation did not survive the Hyg selection. Sclerotium-mediated transformation Both B. cinerea and S.

As a result of the strength of the atomic bonds in carbon nanotubes, they not only can withstand high temperatures but also have been shown to be very good thermal conductors. They can withstand up to 750°C at normal and 2,800°C in vacuum atmospheric pressures. The temperature of the tubes and the outside environment can affect the thermal conductivity of carbon nanotubes [8]. Some of the major physical properties of carbon nanotubes are summarized in Table 2. Table 2 The physical

Selleck Rabusertib properties of carbon nanotubes Physical properties Values Equilibrium structure Average diameter of SWNTs 1.2 to 1.4 nm   Distance from opposite carbon atoms (line 1) 2.83 Å   Analogous carbon atom separation (line 2) 2.456 Å   CX-6258 datasheet Parallel carbon bond separation (line 3) 2.45 Å   Carbon bond length (line 4) 1.42 Å   C-C tight bonding overlap energy Approximately 2.5 eV   Group symmetry EPZ015938 solubility dmso (10, 10) C5V   Lattice: bundles of ropes of nanotubes Triangular lattice (2D) Lattice constant   17 Å  Lattice parameter

(10, 10) Armchair 16.78 Å   (17, 0) Zigzag 16.52 Å   (12, 6) Chiral 16.52 Å  Density (10, 10) Armchair 1.33 g/cm3   (17, 0) Zigzag 1.34 g/cm3   (12, 6) Chiral 1.40 g/cm3  Interlayer spacing: (n, n) Armchair 3.38 Å   (n, 0) Zigzag 3.41 Å   (2n, n) Chiral 3.39 Å Optical properties      Fundamental gap For (n, m); n − m is divisible by 3 [metallic] 0 eV   For (n, m); n − m is not divisible by 3 [semiconducting] Approximately 0.5 eV Electrical transport       Conductance

quantization (12.9 k O )-1   Resistivity 10-4 O -cm   Maximum current density 1,013 A/m2 Thermal transport       Thermal conductivity Approximately 2,000 W/m/K   Phonon mean free path Approximately 100 nm   Relaxation time Approximately 10 to 11 s Elastic behavior       Young’s modulus (SWNT) Methisazone Approximately 1 TPa   Young’s modulus (MWNT) 1.28 TPa   Maximum tensile strength Approximately 100 GPa Synthesis There are several techniques that have been developed for fabricating CNT structures which mainly involve gas phase processes. Commonly, three procedures are being used for producing CNTs: (1) the chemical vapor deposition (CVD) technique [12, 13], (2) the laser-ablation technique [3, 9], and (3) the carbon arc-discharge technique [14–16] (Table 3). High temperature preparation techniques for example laser ablation or arc discharge were first used to synthesize CNTs, but currently, these techniques have been substituted by low temperature chemical vapor deposition (CVD) methods (<800°C), since the nanotube length, diameter, alignment, purity, density, and orientation of CNTs can be accurately controlled in the low temperature chemical vapor deposition (CVD) methods [17].

The SCCmec carries the mecA gene, which encodes penicillin binding protein PBP2a, the main causal factor of methicillin resistance. Different types of SCCmec cassettes and their variants have been identified [10, 11]. The current methods for MRSA detection are based on either the phenotypic expression such as oxacillin resistance, or genotypic characterization. For this study, we used modified Inhibitor Library screening broad-range PCR primers that originate from the conserved regions of genes that encode the topoisomerases together with specific oligonucleotide probes located at hyper-variable regions flanked by the primers. Using these primers and probes, single or even multiple infection-causing bacteria could be simultaneously

Selleck Belnacasan detected and identified. The bacterial pathogen panel of the assay covered the following species: Acinetobacter baumannii, Enterococcus faecalis, Enterococcus faecium, Haemophilus influenzae, Klebsiella pneumoniae, Selumetinib Listeria monocytogenes, Neisseria meningitidis, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes and selected CNS species. These bacteria are examples of highly virulent, potentially multi-antimicrobial resistant or the most common etiologic agents associated with various life-threatening conditions. Such

conditions include: sepsis, infective endocarditis and central nervous system infection. All these conditions necessitate rapid and accurate diagnostics to improve the chances of a positive outcome for

the patient. We used the ArrayTube™ as a microarray platform for the probes. The ArrayTube™ has been demonstrated to detect and selleck products identify bacterial pathogens with a high degree of sensitivity [12–14], differentiate between various pathotypes of the same bacterial species [15] and to be capable of detecting antimicrobial resistance genes [16] from an isolated DNA sample. Furthermore, by including specific primers and probes for the mecA methicillin resistance gene in the same assay, we were able to associate the mecA gene with a particular Staphylococcus species present in the sample. The combination of broad-range PCR and array-based methods provided a sensitive and specific approach for detecting and identifying bacterial pathogens along with finding possible resistance markers. Results Assay design First, we re-designed and modified the bacterial broad-range gyrB/parE primers [4] by using inosines to reduce the level of degeneration. These modifications also facilitated the use of a novel PCR method for the assay (PCR program described in Materials and Methods). The PCR method had two distinct phases: a three-step PCR phase that exponentially produced dsDNA, followed by a two-step PCR phase that took place under two different conditions and which produced ssDNA in a linear manner. The method is based on partly overlapping annealing temperatures of the forward and reverse primers.

The p38 MAPK inhibitor inability of RB50ΔsigE to cause lethal infections in Rag1−/− mice (Figure 4) could be due to failure to enter or survive in the bloodstream and/or systemic organs of these mice. Since the mutation does not affect survival during incubation with serum in vitro, it is unlikely that the sigE-deficient strain is more susceptible to complement or other antimicrobial components in serum. The defect in infection

of Rag1−/− mice may then be related to altered interactions of the mutant strain with phagocytic cells in the bloodstream. RB50ΔsigE is more susceptible to peripheral blood PMNs than RB50 (Figure 6), and is also less cytotoxic to macrophages than RB50 (Figure 5). Either or both of these defects could explain the failure to recover RB50ΔsigE from systemic organs of mice lacking adaptive

immune responses and the decreased virulence in these mice. Why does the RB50ΔsigE mutant spread systemically and cause lethal infection in TLR4def and TNF-α−/− mice, but not Rag1−/− mice? The lower cytotoxicity of the sigE mutant and its learn more increased sensitivity to phagocytic killing does not affect its virulence in mice lacking innate immune functions. This could be because bacterial AZD5363 in vitro numbers within the respiratory tract of TLR4def or TNF-α−/− mice are nearly an order of magnitude higher than in the lungs of Rag1−/− mice. As such, the large number of bacteria in TLR4def or TNF-α−/− mice may overwhelm limiting host antimicrobial defense mechanisms that can contain the lower bacterial numbers in the Sclareol lungs of Rag1−/− mice. Alternatively, although the cytotoxicity of the sigE mutant is reduced, it may still be sufficient to establish lethal infections in the absence of TLR4 or TNF-α. Thus TLR4- and TNF-α-dependent functions, such as efficient phagocytosis and killing, appear to be sufficient to prevent lethal infection by RB50ΔsigE in Rag1−/− mice. Although the exact role remains to be elucidated, our results

clearly indicate that SigE is required for lethal infection of mice lacking B and T cells. Although the B. bronchiseptica strain RB50 causes asymptomatic infections in immunocompetent mice, other strains of B. bronchiseptica can cause a wide range of disease severity in other hosts [11–13]. In particular subsets of immunocompromised humans, such as those infected with HIV, severe systemic B. bronchiseptica infections have been observed [14]. These facts, along with the high degree of sequence conservation for the sigE locus in B. pertussis and B. parapertussis, highlights the importance of understanding the stressors that activate SigE and how the SigE system responds to them during infection. Conclusions In this work, we have demonstrated that the B.

parahaemolyticus in oysters in a field setting. Methods Bacterial strains and DNA templates preparation Strains used in this study (Table 1) were maintained in Luria-Bertani broth (BD Diagnostic Systems, Sparks, MD) containing 30% glycerol at -80°C. V. parahaemolyticus ATCC 27969, originally isolated from blue crab hemolymph was used for sensitivity

testing. Additional 35 V. parahaemolyticus clinical and environmental strains and 39 non- V. parahaemolyticus strains were used to evaluate assay Selleck ��-Nicotinamide specificity. All Vibrio strains were routinely cultured using trypticase soy agar or broth (TSA or TSB; BD Diagnostic Systems) supplemented with 2% NaCl at 35°C overnight. Non-Vibrio strains were grown on Luria-Bertani agar or blood agar (BD Diagnostic Systems). To prepare DNA template, a single bacterial colony grown on appropriate agar plates was suspended in 500 μl of TE buffer (10 mM Tris, pH 8.0; 1 mM EDTA; Sigma-Aldrich, St. Louis, MO) and heated at 95°C for 10 min in a dry heating block. The crude cell lysate was centrifuged at 12,000 g for 2 min and the supernatant was stored at -20°C until use. LAMP primers and reaction conditions The V. parahaemolyticus toxR gene [GenBank:

L11929] was used as the target for LAMP primer design. Five primers, two outer (F3 and B3), two inner (FIP and BIP), and one S3I-201 concentration loop (Loop) which recognized seven distinct regions of the target sequence were designed using the PrimerExplorer software version 4 (Fujitsu Limited, Japan; http://​primerexplorer.​jp/​e. Oligonucleotide sequences and locations of the primers are shown in Table 2. The primers were synthesized by Invitrogen (Carlsbad, CA). The LAMP reaction mix in a 25 μl total volume consisted of the following: 1 × Thermo buffer, 6 mM of MgSO4, 0.8 M of betaine (Sigma-Aldrich), http://www.selleck.co.jp/products/ch5424802.html 1.4 mM of deoxynucleotide triphosphate (dNTP), 0.2 μM of each outer primer (F3 and B3), 1.6 μM of each inner primer (FIP and BIP), 0.8 μM of the loop primer, 8 U of Bst DNA polymerase (New England Biolabs, Ipswich, MA), and 2 μl of DNA template. Additionally, 0.4 μM of

SYTO-9 green fluorescent dye (Invitrogen) was added when the LAMP reaction was carried out in a real-time PCR machine as described below. Two platforms were used to run the LAMP reactions. On the first platform, a real-time PCR machine (SmartCycler II System; Cepheid, Sunnyvale, CA) was used and the SYTO-9 green fluorescent dye was added. The assay was conducted at 63°C for 1 h. Fluorescence buy GSK2245840 readings were acquired every 60 s using the FAM channel (excitation at 450-495 nm and detection at 510-527 nm), followed by melting curve analysis from 63°C to 96°C with 0.2°C increment per second. The fluorescence threshold unit was set to be 30. On the second platform, the LAMP reaction was carried out in a Loopamp real-time turbidimeter (LA-320C; Teramecs, Kyoto, Japan) at 63°C for 1 h and terminated at 80°C for 5 min.

For those North American isolates that are VGII by molecular type, the subtype-specific assays should be performed for typing VGIIa, VGIIb, or VGIIc. As we further our understanding of C. gattii populations around the world and their genotype-phenotype relationships, additional subtype specific assays can be similarly developed for local and global research purposes. Conclusions These PCR-based assays are an Tariquidar affordable,

efficient, and sensitive means of genotyping C. gattii isolates. Both the assay methods and results can be easily transferred among laboratories. Assay results are based on real-time PCR cycle threshold values and are therefore objective and straightforward for local analysis. The assay panel AZD8931 research buy presented here is a useful tool for conducting large-scale molecular epidemiological studies by public health and research laboratories. Ethics statement This study does not involve subjects or materials that would require approval by an ethics committee. Acknowledgements The findings and conclusions of this article are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The authors wish to thank the members of the Cryptococcus gattii Public Health Selleck GW3965 Working Group for submission of many of the isolates used in this study. This work was supported by funds from the National Institutes of Health: R21AI098059. References 1. Bovers M, Hagen F, Boekhout T: Diversity of the Cryptococcus neoformans-Cryptococcus gattii species complex. Rev Iberoam Micol 2008,25(1):S4-S12.PubMedCrossRef 2. D’Souza CA, Kronstad JW, Taylor G, Warren R, Yuen M, Hu G, Jung WH, Sham A, Kidd SE, Tangen K, Lee N, Zeilmaker T, Sawkins J, McVicker G, Shah S, Gnerre S, Griggs A, Zeng Q, Bartlett K, Li W, Wang X, Heitman J, Stajich JE, Fraser JA, Meyer

W, Carter D, Schein J, Krzywinski M, Kwon-Chung KJ, Varma A, et al.: Genome variation in Cryptococcus gattii , an emerging pathogen of immunocompetent hosts. MBio 2011, 2:e00342–10.PubMedCentralPubMed 3. Lockhart mafosfamide SR, Iqbal N, Bolden CB, DeBess EE, Marsden-Haug N, Worhle R, Thakur R, Harris JR: Epidemiologic cutoff values for triazole drugs in Cryptococcus gattii : correlation of molecular type and in vitro susceptibility. Diagn Microbiol Infect Dis 2012,73(2):144–148.PubMedCrossRef 4. Stephen CSL, Black W, Fyfe M, Raverty S: Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can Vet J 2002,43(10):792–794.PubMedCentralPubMed 5. Iqbal N, DeBess EE, Wohrle R, Sun B, Nett RJ, Ahlquist AM, Chiller T, Lockhart SR: Correlation of genotype and in vitro susceptibilities of Cryptococcus gattii strains from the Pacific Northwest of the United States. J Clin Microbiol 2010,48(2):539–544.PubMedCentralPubMedCrossRef 6.

Cerebrovasc Dis 2008, 25:170–175.CrossRefPubMed 26. Yetkin G:Chlamydia pneumoniae and coronary artery disease: controversial results of serological studies. Int Immunopharmacol 2006, 6:1524–1525.CrossRefPubMed 27. Liuba P, Pesonen E: Infection and early atherosclerosis: does the evidence support causation? Acta Paediatr 2005, 94:643–651.CrossRefPubMed 28. Kalayoglu MV, Indrawati, Morrison RP, Morrison SG, Yuan Y, Byrne GI: SB431542 in vivo chlamydial virulence determinants

in atherogenesis: the role of chlamydial lipopolysaccharide and heat shock protein 60 in macrophage-lipoprotein interactions. J Infect Dis 2000,181(Suppl 3):S483–489.CrossRefPubMed SB202190 29. Libby P, Ridker PM, Maseri A: Inflammation and atherosclerosis. Circulation 2002, 105:1135–1143.CrossRefPubMed 30. Khovidhunkit W, Kim MS, Memon RA, Shigenaga JK, Moser AH, Feingold KR, Grunfeld C: Effects of infection and inflammation on lipid and lipoprotein metabolism: mechanisms and consequences to the host. J Lipid Res 2004, 45:1169–1196.CrossRefPubMed 31. Bobkova D, Honsova E, Kovar J, Poledne R: Effect of diets on lipoprotein concentrations in heterozygous apolipoprotein E-deficient mice. Physiol Res 2004, 53:635–643.PubMed 32. Jawieñ J,

Nastałek P, Korbut R: Mouse models of experimental atherosclerosis. J Physiol Pharmacol 2004, 55:503–517.PubMed 33. Higuchi ML, Santos MH, Roggério A, Kawakami JT, Bezerra HG, Canzian M: A role for archaeal organisms in development of atherosclerotic vulnerable plaques and myxoid matrices. Clinics 2006, 61:473–478.CrossRefPubMed 34. NRC. National Research Council: Guide for the care and use of laboratory animals. National Academic Go6983 Press. Washington. DC 35. Kenny GE: Serodiagnosis. Mycoplasmas Molecular Biology and Pathogenesis (Edited by: McElhaney RN, Finch LR, Baseman JB). Washington:American Society for Microbiology 1991, 505–512. 36. Reynolds ES: The use of lead citrate at high pH as an electron-opaque stain in electron microscope. J Cel Biol 1963, 17:208–212.CrossRef 37. Davies G, Reid L: Growth of the alveoli and pulmonary

arteries in childhood. Thorax 1970, 25:669–681.CrossRefPubMed 38. Glagov S, Weisenberg E, Zarins CK, Stankunavicius R, Kolettis GJ: Compensatory enlargement of human atherosclerotic of coronary arteries. N Engl J Med 1987, 316:1371–1375.CrossRefPubMed 39. Nishioka T, Berglund H, Luo H, Nagai T, Siegel RJ: How should we define inadequate coronary arterial remodeling. Circulation 1998, 97:1424–1425.PubMed Authors’ contributions SBD and MLH – carried out the molecular genetic studies, participated in the sequence alignment and drafted the manuscript. MMR and MLH – participated in the design of the study and performed the statistical analysis. JTO; SAPP; RNI and LFPF – participated in the sequence alignment. MHL – conceived of the study, and participated in its design and coordination and helped to draft the manuscript. JT and FCP – carried out the immunoassays.