Steve needed to use a special oscilloscope to achieve his goal; this was only available at the cyclotron lab at Urbana, Illinois, and that too S3I-201 ic50 only at nighttime. Steve did not hesitate to work from midnight until

8 in the morning every day during that period. There, he worked all night for almost 6 months. His adventurous spirit and his dedicated work paid off. Steve made the first direct measurements of the lifetime of fluorescence not only from chlorophyll in solution, but from chlorophyll a in suspensions of the red alga Porphyridium, the green alga Chlorella, and the cyanobacterium Anacystis (Brody 1956, 1957; Brody and Rabinowitch 1957; Rabinowitch and Brody 1958). It is important to mention that independent of Brody’s work at Urbana, Illinois, Alexander Terenin’s famous laboratory at Leningrad University had also built an instrument, that had used a different method, the so-called

phase method, and there, Dmitrievsky et al. (1957) also measured the chlorophyll a fluorescence lifetime in vivo (see Borisov 2003). The lifetime of chlorophyll a fluorescence was found to be in the range of 1 to 1.5 ns in photosynthetic systems, and this was almost 4–5 times click here shorter than for chlorophyll a in solutions. Both KU-60019 mw research groups at Urbana and in Leningrad (St. Petersburg) concluded that the primary reaction of photosynthesis must be through the singlet-excited state of chlorophyll. Later my research group, and that of many others, have extended these lifetimes of fluorescence measurements; see an early review by Jursinic and Govindjee (1979). Another first in the field of photosynthesis

was then the measurement of the 3-mercaptopyruvate sulfurtransferase time (and thus, the rate) of excitation energy transfer from the orange-red pigment phycoerythrin to chlorophyll a in the red alga Porphyridium cruentum (see Brody 1958, 1960; Rabinowitch and Brody 1958; Brody and Rabinowitch 1959). When excited by green light, absorbed by phycoerythrin, the measured time for energy transfer was ~0.5 ns. Much has progressed since then, but this measurement remains the first in the field. (For excitation energy transfer, see e.g., Clegg et al. 2010; Dutton 1997; Duysens 1952; French and Young 1952; Porter et al. 1978.) As mentioned in the Introduction, Steve made still another discovery by using 77 K (liquid nitrogen temperature) spectroscopy after thinking about the obvious—that at low temperature biochemistry stops. Brody (1958) discovered a brand new emission band at 720 nm (F720). Steve had thought then that it was from a “chlorophyll dimer” (perhaps, the reaction center of Photosystem I, what is called P700); it is now known to originate from antenna chlorophyll a complex in Photosystem I. At 77 K, another band at 696 nm (F696) was discovered independently in 1963 in several laboratories (including my (G) own and that of Steve Brody) (see reviews in: Govindjee et al.

A rinsing step of 1 minute in deionized water was performed between the two polyelectrolytes baths and a drying step of 30 seconds was performed after each rinsing step. The combination of a cationic monolayer with an anionic monolayer is called bilayer. The LbL process was carried out using a 3-axis cartesian robot from Nadetech Innovations. More details of the LbL assembly can be found elsewhere [35, 36, 43]. No atmospheric oxidation of the this website LbL films with AgNPs

was observed using this experimental process, showing the long-term stability of the selleck compound resultant films. Characterization UV-visible spectroscopy (UV–vis) was used to characterize the optical properties of the multicolor silver nanoparticles and the resultant coatings obtained by LbL assembly. Measurements were carried out with a Jasco V-630 spectrophotometer. Transmission electron microscopy (TEM) was used to determine the morphology (shape and size) of the silver nanoparticles obtained in aqueous solution. This TEM analysis was carried out with a Carl Zeiss Libra 120. Samples for TEM were prepared by dropping and evaporating the solutions onto a collodion-coated copper grid. Atomic force microscope (AFM) in tapping mode (Innova, Veeco Inc.) has been used in order to show the distribution of the Ag NPs, thickness and roughness of the films obtained by the LbL assembly. Results and discussion

In Figure  1, it is possible to appreciate three different colors obtained (violet, green and orange) using PAA as an encapsulating agent (PAA-AgNPs) when DMAB concentration is increased (from 0,033 mM to 3.33 mM). These poly(acrylic acid)-coated nanoparticles

are Selleck EPZ015938 unique in this respect because prior studies using different encapsulating agents to synthesize silver nanoparticles indicate that only an orange coloration is obtained without any color variation. In addition, the resultant PAA-AgNPs dispersions showed an excellent long-term stability since no changes in the position of their absorption bands have been observed after more than one year of storage at room conditions, corroborated by UV–vis spectroscopy. Figure 1 UV–vis spectroscopy of medroxyprogesterone the multicolor silver nanoparticles (violet, green, orange) as a function of DMAB concentration. Initially, the mixture of 25 mM PAA with AgNO3 is colorless (control), but after the addition of 0.033 mM of DMAB, the mixture turns quickly to violet with a plasmonic absorption peak with a maximum centered at 600 nm. When DMAB concentration is increased (0.33 mM), the sample changes from violet to green. The absorption band distribution in the UV–VIS spectrum was altered significantly. The initial absorption band was increased significantly, and it was also shifted toward longer-wavelengths (at 650 nm). Furthermore, a new absorption band was found at 480 nm related with the coexistence of different Ag-NP aggregation states or shapes. Finally, when DMAB concentration is increased to 3.

The

book can be used as a reference work both for medical advice beyond occupational dermatoses and for an adequate professional dialogue with colleagues in the field of dermatology.”
“Introduction Hairdressers often complain of work-related airway symptoms. They are exposed to several irritating and sensitizing agents, but they often relate their symptoms to bleaching powder (Albin et al. 2002; Brisman et al. 2003). Persulphates found in bleaching powder have often been blamed because they are irritating and sensitizing agents causing both rhinitis and asthmatic symptoms. Specific challenge to persulphate has been suggested as an useful tool in diagnosis of occupational asthma in hairdressers (Muñoz et al. 2004). However, specific IgE antibodies https://www.selleckchem.com/products/MK-2206.html against persulphates are seldom found (Parra et al. 1992) and another immunologic mechanism not yet elucidated has been suggested (Moscato BAY 11-7082 manufacturer et al. 2005; Muñoz et al. 2004). Furthermore, the clinical picture is quite complex as hairdressers reacting to bleaching powder very often complain of symptoms associated with exposure to other hairdressers chemicals. In a previous study, we found that hairdressers with

nasal symptoms from bleaching powder reacted to a nasal challenge with potassium persulphate in the same way as atopics without earlier exposure to bleaching powder (Kronholm selleck Diab et al. 2009). Mirabegron This reaction was associated with a Th1 cell activation, which may be a part of the process of hyper reactivity from low irritant exposure (Banauch et al. 2005; Van Loveren et al. 1996). In an earlier study (Kronholm Diab 2002), hairdressers claimed that their work-related symptoms increased during periods of exposure and also that they became more sensitive to other stimuli as well, indicating an increasing reactivity in the nasal mucosa. They felt that the reactivity decreased considerably during time away from work. For this reason, frequent periods without

exposure were necessary for the hairdressers to be able to continue work. Health-related quality of life (HRQoL) has been introduced late in occupational medical research compared to care health research in general. HRQoL and working life are linked and must be of concern to occupational health researchers (Blanc 2004). Data indicate that allergic rhinitis may have an important impact on productivity because of symptoms as tiredness, poor concentration and headache (Blanc et al. 2001). The mechanisms of hairdressers’ nasal symptoms and the consequences for their HRQoL are not clear. This is problematic when hairdressers ask for medical advice concerning continued work as a hairdresser. To clarify this issue, further research about the symptom mechanism and the influence of the symptoms on HRQoL during exposure periods is of great need.

Hypertension or hyperlipidemia did not have any associations with biomarkers’ levels. However, significant relationships existed between past medical history of diabetes mellitus and TGF-β-72 h (p = 0.033). Moreover, drug history of statins (HMG-CoA reductase inhibitors) had a significant association with selleck chemicals TGF-β-72 h (p = 0.009). Being a smoker had a relationship with the level of TNF-α-24 h (p = 0.049). There was not any association between type of reperfusion management and biomarker levels, while coronary angiographic findings showed a statistically

significant relationship with the TGF-β-72 h level (p = 0.014). The level of TGF-β-72 h had a statistically significant difference between patients with two-vessel disease and those with left main coronary artery (LMCA) disease (p = 0.001). Moreover, significant differences existed between patients with triple-vessel disease and those with LMCA disease (p = 0.021) as the latter had higher levels of TGF-β-72 h. In evaluating associations of echocardiographic findings and biomarker

levels, significant relationships existed between buy GSK1210151A ejection fraction and TGF-β-72 h (p = 0.005) as well as between intraventricular septum abnormality and TNF-α-24 h (p = 0.038). 3.3 Correlations Between Biomarker Levels and Patient Characteristics We found significant correlations between the level of TNF-α-24 h and TGF-β-72 h (r = 0.231, p = 0.03). Significant correlation existed between the level of TNF-α-72 h and glycosylated hemoglobin (HbA1c) serum level ACP-196 (r = 0.655, p = 0.029). The level of TGF-β-24 h had significant correlations with ischemic time (r = −0.233, p = 0.037) as well as cardiac troponin T levels of patients within 6 h of admission Leukotriene-A4 hydrolase (r = 0.218, p = 0.042), white blood cell (WBC) count (r = 0.358, p = 0.001) and ALT serum levels (r = 0.377, p = 0.048). Finally, significant correlations existed between TGF-β-72 h levels and matrix metalloproteinase

(MMP)-9 measured after 72 h (r = 0.330, p = 0.003) in addition to patients’ ejection fraction (r = −0.311, p = 0.009). 4 Discussion Several physiologic pathways including inflammation and fibrosis may involve in the pathogenesis of post-myocardial infarction (MI) structural changes called remodeling. As TNF-α and TGF-β are known to be the major biomarkers that contribute to each of these mentioned mechanisms and NAC is proposed to have beneficial effects in acute cardiology, in this study we evaluated the impact of NAC on these biomarkers. TNF-α tends to peak within 24 h following MI, and decreased toward baseline 3 days after MI [28]. Although the TNF-α level trend was in favor of those who received NAC, the difference was not significant between groups. While we could not find any significant effect on the TNF-α level, NAC could prevent TGF-β from increasing.

4 – 1.8 kg. During the third visit, two subjects, (JG and ZP), exercised indoors at 28°C alternating 10 min on a treadmill and Airdyne Cycle Ergometer.

The remaining subjects easily ran 7.5 km outdoors in sunny conditions at about 32°C. YM155 statistical Analysis Standard statistical methods were employed for the calculation of means and standard deviations (SD). Descriptive data are presented as means ± standard deviation. Primary outcome measures (VO2max and treadmill time) were analyzed using repeated measures ANOVA of the difference between dehydration and rehydration values as the dependent variable. In addition, differences between the three drink replacements were compared using least square means from these models and adjusted for multiple comparisons with the Bonferroni

correction to avoid type I error. The possible influence of dehydration level see more was tested with analysis of covariance. Significance in this study was set at P < 0.05. Results The mean water loss during the initial dehydration BIBF 1120 manufacturer phase ranged from 1.54 – 1.81 kg, corresponding to 1.8 – 2.1% loss in body weight (Table 3). This level of dehydration resulted in minimal effects on maximal HR and V for all individuals. Furthermore, no significant differences were observed in HR or V following rehydration with Crystal Light (control), Gatorade or Rehydrate (AdvoCare International) relative to either baseline values or values derived following

dehydration (Table 3). Table 3 Peak values during the treadmill performance test below for heart rate* and ventilation at baseline, after dehydration and following rehydration     Heart Rate (beats.min-1) Ventilation (L.min-1-btps) Rehydrate Wt loss (kg) Baseline Dehydration Rehydration Baseline Dehydration Rehydration Mean ± SD 1.69 ± 0.54 186.0 ± 15.7 183.5 ± 12.0 185.5 ± 12.5 137.5 ± 18.7 134.1 ± 15.4 139.3 ± 18.0 Gatorade               Mean ± SD 1.54 ± 0.63 186.0 ± 15.7 187.0 ± 14.5 183.0 ± 14.8 137.5 ± 18.7 136.4 ± 18.8 136.3 ± 21.4 Crystal Light               Mean ± SD 1.81 ± 0.59 186.0 ± 15.7 183.5 ± 14.8 180.1 ± 14.3 137.3 ± 18.6 134.0 ± 17.9 134.2 ± 17.4 * Maximal HR not available at baseline. Values for maximal oxygen consumption (VO2max) are provided in Table 4 as both mL.kg-1.min-1 and mL.min-1. Relative to the baseline values, dehydration produced small but non-significant decreases in these values. Rehydration with Crystal Light (control) failed to restore VO2max to baseline values. Rehydration with Gatorade returned VO2max to slightly below baseline values, while rehydration with Rehydrate resulted in a VO2max (mL.min-1) that was 2.9% above the rehydrated state, and above baseline (Table 4).

Slices of appropriate thickness were transferred to copper grids and stained with uranyl acetate (2%) and lead citrate according to Reynolds [43]. EM images of thin sections were recorded using a Tecnai G2 Sphera electron transmission microscope (FEI) equipped with a large area TemCam F224HD CCD camera (TVIPS). The microscope was operated at 120 kV. Over-expression of PhaM and PhaP5 The phaM and phaP5 genes were cloned under control of the (in R. eutropha) constitutively GSK2879552 expressed check details phaC promoter in pBBR1MCS2-PphaC (Table 1). The primer sequences (PhaP5_f_NdeI GGGAATTCCATATGGCCACGCCTCCCAATCC, PhaP5_r_BamHI CGGGATCCCTAGCCCTTGGATTTCGGCTTG and PhaM_f_NdeI GGGAATTCCATATGTTCGGACAGATTCCCGATTTC,

PhaM_r_BamHI CGGGATCCTCAGGCTGCGCTGCTG) were used for amplification of phaP5 and phaM. The respective PCR products were ligated into pBBR1MCS2-PphaC via NdeI & BamHI sites and cloned

in E. coli JM109. Integration and DNA sequence of cloned genes were verified by determination of the DNA sequence. Plasmids were conjugatively transferred from. E. coli S17-1 harbouring the plasmid of interest were conjugatively transferred to R. eutropha H16 or strain HF39 by selection on mineral salts medium supplemented with 0.5% fructose and 350 μg ml-1 kanamycin as described previously [22, Combretastatin A4 mw 32]. The respective strains were grown on NB medium supplemented with 0.2% gluconate as described above. Strains with constitutively expressed fusions of PhaM or PhaP5 with eYfp were expressed in an analogue way. Other methods Molecular biological experiments were performed by standard methods [44]. Fluorescence microscopical analysis of R. eutropha cells harbouring fusion proteins with eYfp in the absence or presence of Nile red was conducted as described previously [34]. Construction of chromosomal deletions of phaP5 and of phaM in R. eutropha strains

has been described elsewhere [22, 32] using a sacB-based system for selection of double cross-over events. In all cases the mutations were verified by PCR-amplification of the mutated gene locus and by determination of the amplified DNA sequence. Only clones ZD1839 with correct DNA sequence were used. Acknowledgements This work was supported by a grant of the Deutsche Forschungsgemeinschaft to D.J. TEM experiments of this work would not have been possible without technical support by M. Schweikert and B. Nitschke that is greatly acknowledged. References 1. Schwartz E, Voigt B, Zühlke D, Pohlmann A, Lenz O, Albrecht D, Schwarze A, Kohlmann Y, Krause C, Hecker M, Friedrich B: A proteomic view of the facultatively chemolithoautotrophic lifestyle of Ralstonia eutropha H16. Proteomics 2009, 9:5132–5142.PubMedCrossRef 2. Pohlmann A, Fricke WF, Reinecke F, Kusian B, Liesegang H, Cramm R, Eitinger T, Ewering C, Pötter M, Schwartz E, Strittmatter A, Voss I, Gottschalk G, Steinbüchel A, Friedrich B, Bowien B: Genome sequence of the bioplastic-producing “Knallgas” bacterium Ralstonia eutropha H16. Nat Biotechnol 2006, 24:1257–1262.PubMedCrossRef 3.

PubMedCrossRef 43. Watanabe S, Kang DH, Feng L, Nakagawa T, Kanellis J, Lan H, Mazzali M, Johnson RJ: Uric acid, hominoid evolution, and the pathogenesis of salt-sensitivity. Hypertension 2002, 40:355–360.PubMedCrossRef 44. Chen H, Mosley TH, Alonso A, Huang X: Plasma urate and Parkinson’s disease in the Atherosclerosis

Risk in Communities (ARIC) study. Am J Epidemiol 2009, 169:1064–1069.PubMedCrossRef 45. Ascherio Selleck AZD1480 A, LeWitt PA, Xu K, Eberly S, Watts A, Matson WR, Marras C, Kieburtz K, Rudolph A, Bogdanov MB, et al.: Urate as a predictor of the rate of clinical decline in Parkinson disease. Arch Neurol 2009, 66:1460–1468.PubMedCrossRef 46. Markowitz CE, Spitsin S, Zimmerman V, Jacobs D, Udupa JK, Hooper DC, Koprowski H: The treatment of multiple sclerosis with inosine. J Altern Complement Med 2009, 15:619–625.PubMedCrossRef Competing interests The

Selleckchem Bucladesine authors declare that they have no competing interests. Authors’ contributions ICWA participated in the design and data analysis of the study, and drafted the manuscript, EJCMC carried out the human intervention study, participated in the data analysis and drafted the manuscript, MJLB participated in the design of the study and helped to draft the manuscript, NH produced the pellets and carried out the dissolution experiments, MACH participated in the design of the study and helped to draft the manuscript, AB participated in the design and conception of the study and helped to draft the manuscript, PCD conceived of the study, participated in the design and coordination of the study, and helped to draft the manuscript. All authors read and approved the final manuscript.”
“Background Supplementation of nutrients is generally accepted as having an ergogenic effect on long-term physical performance (> 2 h) [1]. While carbohydrate (CHO) intake

seems to be crucial, with current recommendations ranging from 30-70 g·h-1 [1, 2], the need for additional nutrients such PLEKHM2 as protein (PRO) remains elusive. Some studies have check details suggested that the addition of protein improves performance [3, 4], while others have suggested that it has no effect [2, 5–7] or even a negative effect [8]. The observed discrepancies have been ascribed factors such as inappropriate choices of test procedures [2, 3, 6, 9], inadequate interpretation of data [9], differences in caloric intake [3] and the physical properties of the protein source [10], and has led to discussion [9, 11]. Taken together, available data sets points towards a complex and unresolved causal connection between protein intake and performance level. The complexity is underlined by the meta-analysis by Stearns et al. [3], which suggested that adding protein to isoCHO beverages, thereby increasing the caloric intake, results in improved performance in time-to-exhaustion trials but not in time trial protocols.

Pharmacokinetic analysis demonstrated that the terminal elimination half life of this peptide is 1.5, Tideglusib cost 3.3, and 3.3 hr, and the subcutaneous bioavailability is 100, 68 and 100% in rat, dog and monkey, respectively. In a mouse pharmacodynamic model, this peptide induces a dose and time-dependent increase of circulating white blood cells/neutrophils and hematopoietic progenitor cells with an ED50 value of

0.74–0.85 mg/kg, and this PD effects last 6–24 hr depending on dose. Similar pharmacodynamic effects were observed in monkey based on an increased level of circulating CD34+ cells, white blood cells and neutrophils. Analysis of pharmacokinetic and pharmacodynamic data from multiple species supports a once daily subcutaneous injection SHP099 in vitro dosing regimen in the clinic. Additionally, the peptide has shown dose-dependent inhibition of tumor growth in multiple human

xenograft models utilizing cell lines that express high levels of CXCR4, such as non-Hodgkin’s lymphoma and lung tumor models. It also inhibits tumor cell buy EPZ5676 metastasis in an experimental breast tumor metastasis model. O179 Inhibition of Cathepsin Proteases Synergizes with Maximum-Dose and Low-Dose Chemotherapy to Block Malignant Progression in a Mouse Model of Metastatic Breast Cancer Tanaya Shree 1,2 , Benelita T. Elie1, Alfred Garfall1, Katherine Bell-McGuinn1, Kenishana Simpson1, Violetta Barbashina1,3, Johanna A. Joyce1 1 Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, NY, USA, 2 Tri-Institutional MD-PhD Program, Well Cornell Medical College/Rockefeller University/Memorial Sloan Kettering Cancer Center, New York, NY, USA, 3 Department enough of Pathology, Memorial Sloan Kettering Cancer Center, New York, NY, USA Cysteine cathepsin proteases are deregulated in many human tumors, and have been implicated in

promoting angiogenesis, invasion, and metastasis. Their genetic ablation or pharmacological inhibition significantly impairs tumor progression in several mouse models. Oncologists rely heavily on maximum tolerated dose (MTD) chemotherapy to treat cancer, but this frequently leads to chemoresistance and has limited efficacy against metastasis, the primary cause of cancer deaths. Continuous low dose (CLD) chemotherapy delivers lower doses at greater frequency, and has been shown to be anti-angiogenic. We hypothesized that combining cathepsin inhibition with agents targeting cancer cells and vasculature could dramatically improve anti-tumor efficacy and prevent metastatic progression. Using a mouse model of breast cancer (MMTV-PyMT), we treated mice with MTD paclitaxel (TaxMTD), CLD cyclophosphamide (CycCLD), and a cathepsin inhibitor (JPM), alone and in combinations. While JPM alone had no effect on mammary tumor burden, it significantly impaired tumor growth when combined with TaxMTD (52% reduction vs. 37% for TaxMTD alone).

Therefore, if monitoring ceases too quickly, an incorrect inference that a crossing structure is ineffective may be drawn. In fact, in some cases monitoring

resources may be more effectively allocated by waiting for a few years after installation of the mitigation measure before starting the ‘after’ monitoring. This may be particularly true when the assessment endpoint is population viability. Similarly, monitoring a site for too long commits resources after they are needed. Thus, sampling should not begin before an effect is expected to have occurred and should continue long enough to detect lagged and/or transient effects. A worst-case scenario is that the sampling duration is too short to detect a real effect and that future mitigation Pinometostat mouse projects reject the

use of a measure that is, in fact, successful. Step this website 6: Select appropriate study sites Selection of mitigation sites If a road mitigation evaluation is to assess the effectiveness of multiple wildlife crossing structures along a road or hundreds of mitigation sites at multiple roads, it may be necessary to sample a subset of the available mitigation sites. The method for selecting an appropriate subset of mitigation sites depends on the overall objective of the evaluation. If the objective is to evaluate the extent to which a road mitigation plan is effective for a target species, one should choose a random sample of mitigation sites from the total number of available mitigation sites. Such evaluation Terminal deoxynucleotidyl transferase aims to provide insight into the average effectiveness of the road mitigation. If the objective is, however, to evaluate whether wildlife crossing structures potentially mitigate road impacts for the target species, one should choose sites that are most likely to demonstrate statistically significant effects

with comparatively little sampling effort in time. The following criteria provide a framework to select mitigation sites in this context: (1) Select sites where the road effect is known or expected to be high. (2) Select sites where the planned construction of the mitigation measures allows for sufficient time for repeated measurements before construction. (3) Select sites for which sufficient replicate sites can be found. (4) Select sites where multiple mitigation measures are planned for a relatively long section of road as this may allow for phasing or manipulating mitigation in an experimental design (see Step 4 above). A mitigation effect is most likely to be detectable where a significant positive shift in population viability—e.g., DAPT manufacturer estimated through a PVA (see, e.g., van der Grift and Pouwels 2006)—can be expected as a result of the road mitigation measures (Fig. 3). This implies selecting sites where on at least one side of the road the amount of habitat available is sufficient for only a small, non-viable population that needs an influx of animals from the opposite side of the road (Fig.

In order to elucidate the conduction mechanisms of the device, the I-V curve is plotted in KU-60019 datasheet the double-logarithmic mode, both the positive and negative bias regions, as shown in Figure 8a,b, respectively. The conduction mechanism being responsible for charge transport in the low-voltage region involves ohmic behavior (since n = 1), but it is different in the medium- and high-voltage regions for the device, where the conduction behavior can be well

described by the space charge-limited current (SCLC) theory [31–36]. Ohmic conduction in LRS is assumed to be caused by the oxygen vacancies which probably provide shallow energy levels below the conduction band edge. The SCLC mechanism BAY 63-2521 manufacturer is generally observed when the electrode contacts are highly carrier injecting. Due to the formation of an interfacial ZrO y layer between Zr and CeO x films, the conduction mechanism in the device behaves according to the SCLC theory since the ZrO y layer is known to provide electron trapping sites and to control the conductivity by trapping and

detrapping. Figure 8 I – V curves of the Zr/CeO x /Pt memory device are displayed in double-logarithmic scale. The linear fitting FLT3 inhibitor results in both ON state and OFF state: (a) positive-voltage region and (b) negative-voltage region. The corresponding slopes for different portions are also shown. Conclusions Resistive switching characteristics of the Zr/CeO x /Pt memory device were demonstrated at room temperature. The conduction mechanisms for low- and high-resistance states are revealed by ohmic behavior and trap-controlled space charge-limited

current, respectively. Selleck Forskolin Oxygen vacancies presented in the CeO x film and an interfacial ZrO y layer was formed, as confirmed by XPS and EDX studies. Long retention (>104 s) at 85°C and good endurance with a memory window of HRS/LRS ≥ 40 were observed. This device has high potential for nonvolatile memory applications. Acknowledgements The authors acknowledge the financial support by the Higher Education Commission (HEC), Islamabad, Pakistan, under the International Research Support Initiative Program (IRSIP). This work was also supported by the National Science Council, Taiwan, under project NSC 99-2221-E009-166-MY3. References 1. Tseng TY, Sze SM (Eds): Nonvolatile Memories: Materials, Devices and Applications. Volume 2. Valencia: American Scientific Publishers; 2012:850. 2. Panda D, Tseng TY: Growth, dielectric properties, and memory device applications of ZrO 2 thin films. Thin Solid Film 2013, 531:1–20.CrossRef 3. Panda D, Dhar A, Ray SK: Nonvolatile and unipolar resistive switching characteristics of pulsed ablated NiO films. J Appl Phys 2010, 108:104513.CrossRef 4. Lin CY, Lee DY, Wang SY, Lin CC, Tseng TY: Reproducible resistive switching behavior in sputtered CeO 2 polycrystalline films. Surf Coat Technol 2009, 203:480–483.CrossRef 5.