The same colorectal cancer homogenate and aliquot of Freund’s incomplete adjuvant selleck Palbociclib were subcutaneously injected on the seventh and fourteenth days, respectively. Seven days after the last immune, blood samples were collected and used for determination of the antibody titer by ELISA. When the antibody titer reached above 1:512, the spleens of the mice were removed, immediately frozen by liquid nitrogen, and used for extraction of total RNA. Specific cDNA was synthesized from RNA samples with random primer using the RevertAid First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer’s instructions. The Fd chain, Lambda chain, and Kappa chain were then synthesized from the cDNA with 37 pairs of primers which were designed to anneal with mouse FR1 and CH1 or CL regions with high fidelity Taq DNA polymerase (Fermentas, USA), respectively.

PCR amplification was performed for 35 cycles (1min at 94��C, 1min at 55��C, and 1min at 72��C) in a Thermal Cycler S100 (Bio-Rad, CA, USA). PCR products were pooled into independent collections of Fd chain, �� chain, and �� light chain and purified by using an AxyPre DNA Gel Extraction Kit (Axygen, CA, USA). The recombinants with Fd were performed according to the method described as ��Antibody Phage Display Methods and Protocols�� [13]. The recombinants with light chain and pGEM-T were firstly digested by Xba I and Sac I (Fermentas, USA), then ligated into the Fd-pComb3 library, and transfected into E. coli XL1-Blue cells (Stratagene, CA, USA) repeatedly to obtain the Fab library (>106CFU).

The presence and size of the inserts were further confirmed sequentially with Xho I/Spe I and Xba I/Sac I.2.3. Cloning and Expression of the P-gp Transmembrane RegionA gene encoding 185 amino acids covering P-gp transmembrane region was isolated from the colon cancer tissues and amplified by PCR using the sense primer 5��CCGGAATTCCTCACCAAGCGGCTCCGAT 3�� and the antisense primer 5��CCGCTCGAGGAGTTTATGTGCCACCAAGTAG 3�� and then cloned into a pET28a (+) vector. The recombinant was further verified by sequencing. The positive recombinants were selected and amplified by adding 1.0mM IPTG for 6h at 30��C. Cell pellets were collected by centrifugation at 14,006��g for 3min. Protein was extracted from the cell pellets by using the nickel column (GE Healthcare, CA, USA). The purified P-gp21 was verified by Western blot with the His-tag monoclonal antibody (1:2000) (Protein Tech, CA, USA).2.4. Phage Display and Screening of the ClonesPhagemid rescuing and the Fab displayed library screening were conducted according to the protocol described [14]. Phage particles exposing antibody fragments were rescued from the Fab library Anacetrapib with helper phage with VCSM13 helper phage (2.6 �� 1011pfu/mL) on a 20mL scale.