coli – S. aureus shuttle vector, tetL; Tcr [31] pKOR1 E. coli – S. aureus shuttle plasmid, for creating markerless deletions; repF (ts), cat, attP, ccdB, ori ColE1, bla, P xyl/tetO, secY570; Apr, Cmr [25] pKOR1-VraR::stop pKOR1 construct selleckchem containing mutant vraR insert with XhoI site and two inframe stop codons inserted between the 2nd and 3rd vraR codons. [26] p sas016 p- luc + pBUS1 containing the sas016 promoter-luciferase reporter gene fusion [26] p tcaA p- luc + pBUS1 containing the tcaA promoter-luciferase reporter gene fusion

This study p sa0908 p- luc + pBUS1 containing the sa0908 promoter-luciferase reporter gene fusion This study a Abbreviations: Tcr, tetracycline resistance; Apr, ampicillin resistance; Cmr, chloramphenicol resistance Susceptibility tests The MICs of antibiotics were determined by Etest (BioMérieux) on LB plates swabbed with an inoculum of 0.5 McFarland and incubated at 37°C for 24 h. The MICs of flavomycin, D-cycloserine, tunicamycin and lysostaphin were determined by microdilution in LB broth, essentially as recommended by the Clinical and Laboratory Standards Institute [21]. Northern Blots Northern blots were performed as previously described [22]. Overnight cultures were diluted to OD 0.05 in prewarmed LB containing tetracycline buy AR-13324 and grown to approximately

OD 0.5. Cultures were induced with CBL0137 mouse increasing concentrations of oxacillin and a control culture was grown without antibiotic treatment. Samples were taken after 20 min and 60 min of induction and total RNA was extracted as described by Cheung et al. [23]. RNA samples (7 μg) were separated in a 1.5% agarose-20 mM guanidine thiocyanate gel in 1 × TBE buffer [24]. Digoxigenin (DIG)-labelled probes were amplified using the PCR DIG Probe synthesis kit (Roche) and primer pairs SAS016.for (TCATACGTTCTATGTCTGAT) and SAS016.rev (GATCTATATCGTCTTGTAAT); and luc+ (GGCAATCAAATCATTCCGGATACTG) and luc- (ATCCAGATCCACAACCTTCGCTTC). Construction

of vraR mutant The pKOR1 system developed by Bae et al. [25] was used to inactivate VraR in BB255, by inserting an XhoI site and two stop codons in-frame into the beginning of the vraR coding Florfenicol sequence, truncating VraR after the 2nd amino acid, as previously described [26]. Luciferase reporter gene fusions Promoter regions of sas016 (SACOL0625) , tcaA and sa0908 (SACOL1065) were PCR amplified from S. aureus strain COL using primer pairs: sas016.lucF (AATTA GGTACC TGGATCACGGTGCATACAAC) and sas016.lucR (AATTA CCATGG CCTATATTACCTCCTTTGC); tcaA.lucF (TAAT GGTACC AGTATTAGAAGTCATCAATCA) and tcaA.lucR (TAAT CCATGG TTTCACCTCAATTCTGTTCCT), and sa0908.lucF (AATTA GGTACC ATAA TAGTACACACGCATGT) and sa0908.lucR (TTAAT CCATGG TTGATGCTCCTA TATTAAATT), respectively. PCR products were digested with Asp718 and NcoI and ligated directly upstream of the promoterless luciferase (luc+) gene in vector pSP- luc+ (Promega).