However, at pH values higher than

pH 12 5, DNA degradatio

However, at pH values higher than

pH 12.5, DNA degradation was also observed. When the DNA–Imu3 complex was heated to 100°C for 5 min in the presence of different NaCl concentrations, separation of Imu3 from DNA was observed at 0.5 M NaCl or higher click here (Additional file 3: Figure S3). Incubation of Imu3-DNA complexes with proteinase K resulted in unbound DNA due to degradation of Imu3. To determine whether DNA exposed to Imu3 could subsequently be used for molecular biological manipulations, linear plasmid pBR322 DNA that had been previously complexed with Imu3 was purified with the QIAgen commercial kit. This DNA could be re-ligated, transformed into E. coli, and again subjected to restriction enzyme activity. The integrity

of precipitated and religated plasmid DNA was confirmed on the basis of expression of the ampicillin resistance gene among 500 analysed transformants INCB024360 in vivo (described in Methods). All procedures were also performed with DNA that had not been previously complexed as a control, and no apparent losses in quantity or quality of DNA were observed (with exception of losses originating from the DNA purification procedure) (Figure  7). Further, we found that Imu3 precipitated DNA from highly (1.5 × 10-4 fold) diluted solutions, where 1 μL (100 ng) of linear plasmid DNA was diluted in 15 mL. This procedure yielded less DNA as the control but could without doubt be optimised with appropriate protocol modification (Additional file 4). The colicin DNases and their cognate immunity proteins are known to form high affinity complexes with the DNase domain [11, 12]. In the present study, despite its two preserved histidines, as nuclease inactivation motifs that are present throughout the DNase immunity protein family, Imu3 showed no coupling with the USP protein, and Imu3 alone was shown to be sufficient for protection

of Usp-producing cells. Not unexpectedly due to the sequence similarity of Imu3 with the colicin E7 immunity protein, which was shown by Dennis et al. [12] to be monomeric, we demonstrated, on the basis of different experiments that Imu3 does not undergo dimerisation or multimerisation. Figure 7 Representative electromobility shift assays of re-ligated DNA previously complexed with Imu3 Verteporfin in vitro (0.8% agarose gels). Lane 1, 100 ng pUC19/EcoRI DNA; lane 2: 100 ng pUC19/EcoRI DNA purified with the QIAprep kit; lane 3: 100 ng pUC19/EcoRI DNA–Imu3 complex purified with the QIAprep kit; lane 4: ligation reaction of purified DNA; lane 5: ligation reaction of purified DNA–Imu3 complex; lane 6: restriction (EcoRI) of ligation reaction of purified DNA (from lane 4); lane 7: restriction (EcoRI) of ligation reaction of purified DNA–Imu3 complex (from lane 5). M: λ/PstI marker. To the best of our knowledge, no known functions have been described yet for the protein products of orfU1, orfU2 and orfU3 (here referred to as Imu1, Imu2 and Imu3).

NSC-102-2120-M-110-001 and NSC 101-2221-E-110-044-MY3 References

NSC-102-2120-M-110-001 and NSC 101-2221-E-110-044-MY3. References 1. Rodbell KP, Heidel DF, Tang HHK, Gordon MS, Oldiges P, Murray CE: Low-energy proton-induced

single-event-upsets in 65 nm node, silicon-on-insulator, latches and memory cells. IEEE Trans Nucl Sci 2007, 54:2474.CrossRef 2. Xu ZG, Huo ZL, Zhu CX, Cui YX, Wang M, Zheng ZW, Liu J, Wang YM, Li FH, Liu M: Performance-improved nonvolatile memory with aluminum nanocrystals embedded in Al 2 O 3 for high temperature check details applications. J Appl Phys 2011,110(10):104514.CrossRef 3. Jiang DD, Zhang MH, Huo ZL, Wang Q, Liu J, Yu ZA, Yang XN, Wang Y, Zhang B, Chen JN, Liu M: A study of cycling induced degradation mechanisms in Si nanocrystal

memory devices. Nanotechnology 2011, 22:254009.CrossRef 4. Chang TC, Jian FY, Chen SC, Tsai YT: Developments in nanocrystal memory. Mater Today 2011,14(12):608.CrossRef 5. Liu J, Wang Q, Long SB, Zhang MH, Liu M: Metal/Al 2 O 3 /ZrO 2 /SiO 2 /Si (MAZOS) structure for high-performance non-volatile memory application. Semicond Sci Technol 2010, 25:055013.CrossRef 6. Chen CH, Chang TC, Liao IH, Xi PB, Hsieh J, Chen J, Huang T, Sze SM, Chen US, Chen JR: Tungsten oxide/tungsten nanocrystals for nonvolatile memory devices. Appl Phys Lett 2008,92(1):013114.CrossRef 7. Chung WF, Chang TC, Li HW, Chen SC, Chen YC, Tseng TY, Tai YH: Environment-dependent thermal instability of sol–gel derived amorphous indium-gallium-zinc-oxide selleck kinase inhibitor thin film transistors. Appl Phys Lett 2011,98(15):152109.CrossRef 8. Tsao SW, Chang TC, Huang SY, Chen MC, Chen SC, Tsai CT, Kuo YJ, Chen YC, Wu WC: Hydrogen-induced improvements in electrical characteristics of a-IGZO thin-film transistors. Solid State Electron 2010, 54:1497.CrossRef 9. Chen TC, Chang TC, Hsieh TY, Tsai CT, Chen SC, Lin CS, Hung MC, Tu CH, Chang JJ, Chen PL: Light-induced instability of an InGaZnO thin film transistor with and without SiO x passivation Phosphoglycerate kinase layer formed by plasma-enhanced-chemical-vapor-deposition. Appl Phys Lett 2010,97(19):192103.CrossRef

10. Chen TC, Chang TC, Hsieh TY, Lu WS, Jian FY, Tsai CT, Huang SY, Lin CS: Investigating the degradation behavior caused by charge trapping effect under DC and AC gate-bias stress for InGaZnO thin film transistor. Appl Phys Lett 2011,99(2):022104.CrossRef 11. Zhu CX, Huo ZL, Xu ZG, Zhang MH, Wang Q, Liu J, Long SB, Liu M: Performance enhancement of multilevel cell nonvolatile memory by using a bandgap engineered high-kappa trapping layer. Appl Phys Lett 2010, 97:253503.CrossRef 12. Zhu CX, Xu ZG, Huo ZL, Yang R, Zheng ZW, Cui YX, Liu J, Wang YM, Shi DX, Zhang GY, Li FH, Liu M: Investigation on interface related charge trap and loss characteristics of high-k based trapping structures by electrostatic force microscopy. Appl Phys Lett 2011, 99:223504.CrossRef 13.

Proc Natl Acad Sci USA 1994,91(5):1932–1936 PubMedCrossRef 13 Be

Proc Natl Acad Sci USA 1994,91(5):1932–1936.PubMedCrossRef 13. Berinstein A, Roivainen M, Hovi T, Mason PW, Baxt B: Antibodies to the vitronectin receptor (integrin αvβ3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells. J Virol 1995,69(4):2664–2666.PubMed 14. Neff S, Sa-Carvalho D, Rieder E, Mason PW, Blystone SD, Brown EJ, Baxt B: Foot-and-mouth disease virus virulent for

cattle utilizes the integrin αvβ3 as its receptor. J Virol 1998,72(5):3587–3594.PubMed 15. Jackson T, Sheppard D, Denyer M, Blakemore W, King AMQ: The epithelial integrin αvβ6 is a receptor for foot-and-mouth disease virus. J Virol 2000,74(11):4949–4956.PubMedCrossRef 16. Jackson T, Mould AP, Sheppard D, King selleckchem AMQ: Integrin αvβ1 is a receptor for Selleck CHIR-99021 foot-and-mouth disease virus. J Virol 2002,76(3):935–941.PubMedCrossRef 17. Jackson T, Clark S, Berryman S, Burman A, Cambier S, Mu D, Nishimura

S, King AMQ: Integrin αvβ8 functions as a receptor for foot-and-mouth disease virus: role of the β-chain cytodomain in integrin-mediated infection. J Virol 2004,78(9):4533–4540.PubMedCrossRef 18. Sa-Carvalho D, Rieder E, Baxt B, Rodarte R, Tanuri A, Mason PW: Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J Virol 1997,71(7):5115–5123.PubMed 19. Martínez MA, Verdaguer N, Mateu MG, Domingo E: Evolution subverting essentiality: dispensability of the cell attachment Arg-Gly-Asp motif in multiply passaged foot-and-mouth disease virus. Proc Natl Acad Sci USA 1997,94(13):6798–6802.PubMedCrossRef 20. Ruiz-Jarabo CM, Sevilla N, Da’vila M, Gomez-Mariano G, Baranowski E, Domingo E: Antigenic properties and population stability of a foot-and-mouth disease virus with altered Arg-Gly-Asp receptor-recognition motif. J Gen Virol 1999,80(8):1899–1909.PubMed 21. Baranowski E, Ruíz-Jarabo CM, Sevilla N, Andreu D, Beck E, Domingo E: Cell recognition by foot-and-mouth

disease virus that lacks the RGD integrin-binding motif: flexibility in aphthovirus receptor usage. J Virol 2000,74(4):1641–1647.PubMedCrossRef 22. Jackson T, Ellard FM, Abu-Ghazaleh R, Brookes SM, Blakemore WE, Corteyn AH, Stuart DL, Newman JWI, King AMQ: Efficient infection of cells in culture by type O foot-and-mouth disease virus requires Dimethyl sulfoxide binding to cell surface heparan sulfate. J Virol 1996,70(8):5285–5287. 23. Fry EE, Newman JWI, Curry S, Najjam S, Jackson T, Blakemore W, Lea SM, Miller L, Burman A, King AMQ, Stuart DI: Structure of Foot-and-mouth disease virus serotype A 10 61 alone and complexed with oligosaccharide receptor: receptor conservation in the face of antigenic variation. J Gen Virol 2005,86(7):1909–1920.PubMedCrossRef 24. Mateu MG: Antibody recognition of picornaviruses and escape from neutralization: a structural view. Virus Res 1995,38(1):1–24.PubMedCrossRef 25.

The pellet samples after normalization to 12 5 O D 600/ml, were b

The pellet samples after normalization to 12.5 O.D.600/ml, were boiled for 10 min in 1 x SDS-loading dye as above. After the run, proteins were either Coomassie stained or transferred

onto a polyvinylidene difluoride (PVDF) membrane (Immobilon P, Millipore) using a semi-dry blot. BvgS, a non-secreted protein control was detected using polyclonal mouse antiserum at a dilution of 1:1000 [21]. Pertactin (PRN), which is secreted by a non-T3SS dependent pathway, was identified using a monoclonal mouse antibody at a dilution of 1:1000 [22]. Bsp22, a T3SS substrate control, was detected using polyclonal mouse serum at a dilution of 1:10,000 [23]. Immunodetection was carried out by chemifluorescence using horseradish peroxidase-labeled goat anti-mouse IgG and the ECL plus® detection substrate (GE Healthcare). Chemifluorescent signals were visualized using a Typhoon scanner (GE Healthcare). www.selleckchem.com/products/azd4547.html Genomic DNA extraction, PCR-based detection and genome sequencing DNA was extracted from overnight cultures of various isolates using the PureLink genomic DNA kit as per manufacturer’s instructions (Invitrogen Corporation, USA). PCR was performed according to the manufacturer’s instructions (0.5 U of iproof polymerase, 200 μM each of the four dNTPs and 1 μM each Nutlin 3 primer) and supplemented with 3% dimethyl sulphoxide

(DMSO). Primers B77_QseC1F (5′- ATGACTTTGCAGCGCAGGTT −3′) and B77_QseC1R (5′- AGAAACGCGATCAGCACGGG −3′) or primers B77_QseC2F (5′- GGAGATCTTGCCGTCGCCAT-3′) and B77_QseC2R (5′-ACTTCCCATTGCGCGCGTAG-3′) were used to amplify qseC sequences, and primers B77_QseB1F (5′- GAGAATTCTTATTGTCGAAG-3′) and B77_QseB1R

(5′- GATTCCCAGTCATACAGCTT −3′) were used to amplify qseB. Cycling parameters were: one cycle of 98°C for 1 min; 25 cycles of 98°C for 10 s, 55°C for 20 s and 72°C for 30 s; and a final incubation at 72°C for 5 min. The PCR products were fractionated on 1% agarose gel using 1X TBE buffer containing 5 μg/ml ethidium bromide. PCR products of the extracted DNA were then purified Suplatast tosilate for sequencing using Qiagen’s QIAquick purification kit (Qiagen, Valencia, USA). Bordetella genomes were sequenced by the Sequencing Group at the Sanger Center and can be obtained from ftp://​ftp.​sanger.​ac.​uk/​pub/​pathogens/​bp. Construction of bscN and bteA in-frame deletion mutants To construct in-frame deletions of codons 171–261 in the bscN locus, allelic exchange was performed using pEGBR1005 suicide plasmid derivatives as previously described by Yuk et al. [15]. For construction of bteA in-frame deletions (codons 4–653), suicide plasmid pRE112-bteA was used as previously described by Panina et al. [11]. All mutants were verified by sequencing target open reading frames. Cell lines Cell lines used in this study were obtained from the American Tissue Culture Collection (ATCC).

Table 2 Prognostic factors for disease specific survival in 169 p

Table 2 Prognostic factors for disease specific survival in 169 patients who underwent curative surgery Variable n Univariate Multivariate Hazard ratio 95% CI P -value Hazard ratio 95% CI P -value Age (≥65) 97 1.38 0.73 – 2.70 0.327       Gender (male) 128 1.27 0.60 – 2.49 0.517       Tumor location (distal) 107 0.42 0.22 – 0.78 0.006 0.53 0.27 – 1.05 0.067 Carcinoembryonic antigen (>5 ng/ml) 27 1.71 0.73 – 3.56 0.202       Carbohydrate antigen 19–9 (>37 IU/ml)

23 2.33 0.99 – 4.90 0.054       Tumor size (≥50 mm) 76 3.02 1.54 – 6.35 0.001 2.06 0.98 – 4.57 0.056 Tumor depth (pT4, UICC) 55 2.82 1.50 – 5.39 0.001 1.09 0.52 – 2.32 0.815 Tumor differentiation (undifferentiated) 89 1.79 0.93 – 3.60 0.081       Lymphatic involvement 137 5.70 BTK inhibitor ic50 1.74 – 35.2 0.002 1.12 0.14 – 6.12 0.905 Vessel invasion 83 4.10 2.02 – 9.20 <0.001 2.93 1.31 – 7.52 0.008* Invasive growth 41 2.51 1.31 – 4.73 0.006

1.39 0.64 – 3.00 0.404 Lymph node metastasis 86 8.70 3.71 – 25.5 <0.001 4.01 1.40 – 14.6 0.008* Expression of DPYSL-3 mRNA (high) 84 2.36 1.22 – 4.72 0.010 2.22 1.14 – 4.49 0.019* *Statistically significant in multivariable analysis. GC, gastric cancer; CI, confidence interval; UICC, Union for International Cancer Control. Subgroup analysis based on tumor differentiation The prognostic impact of DPYSL3 expression was evaluated in each patients Epigenetics Compound Library in vitro subgroups classified by tumor differentiation. Although statistically significant pheromone difference was exhibited only in patients with differentiated GCs, similar tendency was observed between survival curves of patients with differentiated and undifferentiated GCs. Discussion DPYSL3, located

on 5q32 and encoding a 62-kDa protein [11], has been gaining attention as a metastasis modulator [14,15]. Interestingly, conflicting results have been reported in prostate and pancreatic cancer, implying that DPYSL3 has a diversity of functions among malignancies. In prostate cancer, the expression of both DPYSL3 mRNA and protein was inversely associated with lymph node metastasis and VEGF expression, and forced DPYSL3 expression in cell lines decreased metastasis in a mouse metastatic model [14]. Alternatively, DPYSL3 promoted adhesion and migration in pancreatic cancer cells in vitro as well as metastasis in vivo via activation of other cell adhesion genes [15]. In this study, the association between DPYSL3 expression and malignant behavior of GC was investigated. First, the transcriptional status of DPYSL3 and potential interacting genes were evaluated in GC cell lines. The expression of DPYSL3 mRNA was heterogeneous in each GC cell line, and it showed a significant correlation with known tumor promoting factors (VEGF, FAK and EZR) [27-29]. These results indicated that DPYSL3 may be associated with the activation of cancer cell proliferation and metastasis, as is the case with pancreatic cancer.

Diverticulitis Sigmoid diverticulitis is a common disease of the

Diverticulitis Sigmoid diverticulitis is a common disease of the Western World and results in a significant number of hospital admissions. Antibiotics are the standard of care for uncomplicated diverticulitis. Percutaneous drainage is the intervention of choice for simple uniloculated abscesses. It has a success

rate of more than 80%, but it may have a high failure rate in cases of complex multiloculated or inaccessible abscesses [49]. The use of antibiotics and percutaneous drainage in the management of diverticular abscesses EPZ-6438 purchase facilitates single stage operation to perform subsequently an elective sigmoidectomy. Ambrosetti et al. [50] studied retrospectively 73 patients with diverticular abscesses with a follow up of 43 months and found that 59% of the patients needed surgery either during the acute admission or as an elective procedure. The other patients

did not need surgical intervention after conservative treatment either with or without percutaneous drainage. The study also compared the mesocolic abscesses with the pelvic ones. Pelvic abscesses exhibited an aggressive behaviour and therefore needed to be rapidly drained find more percutaneously and were likely to require surgery. Brandt et al. [51] retrospectively compared patients with CT confirmed abscesses, treated by antibiotics alone and patient treated by antibiotics with percutaneous drainage. The patients treated with antibiotics alone achieved an outcome similar to patients treated with percutaneous drainage. The average abscess size was 4 cm in the antibiotic only group and 6 cm in percutaneous group. Failure rate of percutaneous drainage in this series was 33%. Siewert et al. [52] reported that antibiotics alone were effective in resolving acute symptoms for abscess size less than 3 cm. Urgent surgery for colonic diverticula perforations is indicated in patients with large or/and multiloculated diverticular abscesses inaccessible to percutaneous drainage or in whom clinical symptoms persist after CT guided percutaneous drainage, diverticulitis associated with free perforation and purulent or

fecal diffuse peritonitis. There is still controversy about the optimal surgical management of colonic diverticular disease, complicated by peritonitis. Hartmann’s resection very has been considered the procedure of choice in patients with generalized peritonitis and remains a safe technique for emergency colectomy in perforated diverticulitis, especially in elderly patients with multiple co-morbidities [53]. More recently, some reports have suggested that primary resection and anastomosis is the preferred approach to diverticulitis, even in the presence of diffuse peritonitis [54, 55]. In 2006 a sistematic review by Constantinides et al. [56] about primary resection with anastomosis vs. Hartmann’s procedure in nonelective surgery for acute colonic diverticulitis was published.

At the same time, production of diffusible compounds spreading th

At the same time, production of diffusible compounds spreading through the substrate by bacterial bodies is both well documented in the literature (see Discussion) and convincingly demonstrated in at least some of our experiments (note gradients of red pigment around R colonies in Figure 2a and 2b, as well as the development of X colonies). We thus proposed the following model, which includes both volatile (airborne) and diffusible (agar-borne) signals. It has been successfully implemented

in a computer program simulating the temporal development of the F colony cross-section profile (Figure 6; Additional file 1; see also Methods). Figure 6 The model. a. Possible states and state transitions of bacterial cells,. All transitions allowed by the formal model are shown, regardless whether they take place during normal colony development; open arrows indicate production of quorum (downwards; arrow size is proportional to the intensity learn more of production) and odor (upwards) signals. Each transition is labeled by the triggering factor (N – colony thickness, Hydroxychloroquine nmr A – time spent in early stationary phase, Qlim – limiting quorum concentration, Olim1 and Olim2 – limiting odor level). b, c. Development of simulated rimmed and rimless colonies. Temporal development of colony size and odor level (b), and colony sections and quorum concentration profiles at selected points during colony

development (c). All values are in relative/arbitrary units. Quorum and sensitivity parameters (quorum limit for inhibition Qlim, limiting odor concentration

for growth reactivation Olim1 and limiting odor concentration Histamine H2 receptor for growth inhibition Olim2) for the simulations are shown in the figure. Other simulation parameters were: maximum colony thickness N = 140; quorum production factor P = 1; odor production factor O = 0.01; stationary to exponential quorum production ratio S = 10; quorum production window A = 5; normalized diffusion factor D = 0.495; diffusion approximated by G = 5 iterations. In the course of the F colony development, a bacterial cell enters a succession of distinct states as follows (Figure 6a). In State 1, corresponding to freshly inoculated or “”young”" growing cells, the bacteria divide exponentially, resulting in a juvenile colony increasing in both its height and diameter. Cells in state 1 produce moderate amounts of a diffusible factor (further referred to as the “”quorum”") that spreads slowly through the substrate and inhibits their own growth if above a threshold concentration (Qlim in the model). When reaching Qlim, or as a result of nutrient limitation (approximated by a maximum colony thickness N in the model), cells stop dividing and enter State 2, corresponding to the early stationary phase and characterized by increased production of the quorum signal. At this stage, the developing colony consists of a core of non-growing cells in state 2, with a margin containing still-growing state 1 bacteria.

For pediatric patients with complicated intra-abdominal infection

For pediatric patients with complicated intra-abdominal infection, ertapenem, meropenem, imipenem/cilastatin, ticarcillin-clavulanate, and piperacillin-tazobactam as single-agent therapy or Ceftriaxone, cefotaxime, cefepime, ceftazidime, each in combination with metronidazole, gentamicin or tobramycin, each in combination with metronidazole or clindamycin, and with or without ampicillin are recommended [103]. Beta-lactam/beta-lactamase inhibitor combinations, have been widely used in the last decade. Their in vitro activity includes gram-positive (include Enterococci in their spectrum), gram-negative and learn more anaerobe organisms [107, 108]. Among beta-lactam/beta-lactamase

inhibitor agents, ticarcillin/clavulanate and ampicillin/sulbactam have been used in the treatment of intra mild to moderate intra-abdominal infections. Ampicillin-sulbactam is still indicated for community infections of mild-to-moderate severity [109], however the increasing resistance of Enterobacteriaceae reported in the last decade could compromise its clinical effectiveness [110]. Piperacillin/tazobactam is a beta-lactam/beta-lactamase inhibitor combination with increased gram-negative spectrum and anti-pseudomonas activity. Piperacillin/tazobactam retains in vitro activity against broad-spectrum beta-lactamase-producing, many extended-spectrum beta-lactamase-producing Enterobacteriaceae

and many Pseudomonas isolates. It is still a reliable option for the empiric treatment of high risk intra-abdominal infections [111]. Carbapenems have a spectrum selleck compound of antimicrobial activity that includes Gram-positive (except resistant gram positive cocci) and Gram-negative aerobic and anaerobic pathogens. Group 1 carbapenems

includes ertapenem, a once a day carbapenem that shares the activity of imipenem and meropenem against most species, including extended-spectrum β-lactamase (ESBL)-producing pathogens [112, 113], but is not active against non-fermentative gram negative and Enterococcus. Ertapenem is particularly suitable for low risk community-acquired intra-abdominal infections. Once-daily ertapenem is an interesting option for the treatment of these infections. Group 2 includes imipenem/cilastatin, meropenem and doripenem, Histone demethylase that share activity against non-fermentative gram-negative bacilli and are particularly suitable for severe infections. Doripenem is a new 1-β-methyl carbapenem recently approved by the Food and Drug Administration for the treatment of complicated intra-abdominal infections and complicated urinary tract infections. Doripenem similarly to imipenem and meropenem, has a broad-spectrum activity against Gram-positive, Gram-negative, and anaerobic bacteria [114, 115]. Doripenem is more effective, in vitro, than meropenem and imipenem against Pseudomonas aeruginosa [116, 117].

celebicus Lambang Clustering 478 2053 5 27 159 6 Calamus symphysi

Open Access This article is distributed under

the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. Appendix See Tables 4 and 5. Table 4 List of rattan palms found the eights study sites in LLNP Species Scientific name Local name Growth form Individuals Shoots Study sites Transects Plots 1 Calamus didymocarpus Moli Clustering 45 188 1 5 26 2 Calamus kandariensis Putih Clustering 107 335 2 15 61 3 Calamus leptostachys Togisi––Togisi nona Solitary 2559 2561 3 21 173 4 Calamus minahassae Tani Solitary 32 32 3 10 21 5 Calamus ornatus var. celebicus Lambang Clustering 478 2053 5 27 159 6 Calamus symphysipus Ombol Solitary 226 226 3 15 89 7 Calamus zollingeri Batang Clustering 645 3651 5 27 191 8 Calamus sp. 1 Tohiti––Asli Solitary 213 213 2 3 20 9 Calamus sp. 2 Uban Solitary 7 7 3 3 5 10 Calamus Akt inhibitor sp. 3 Botol Solitary 518 518 2 11 67 11 Calamus sp. 4 Tohiti Solitary 53 53 1 3 12 12 Calamus sp. 5 Pahit––Humampu Clustering 1032 2058 3 17 128 13 Calamus sp. 6 Tohiti nona––Manda Solitary 78 78 2 7 33 14 Calamus sp. 7 Tohiti Solitary 160 160 2 4 23 15 Calamus sp. 8 Tohiti Solitary 2 2 1 1 1 16 Calamus sp. 9 Botol asli Solitary 150 150 2 8 24 17 Calamus sp. 10 Tohiti batu––Patani––Kuruku Solitary 150 150 4 10 44 18 Calamus Talazoparib in vivo sp. 11 Uban Solitary 103 103 2 5 20 19 Calamus sp. 12 Leilolo––Ronti––Kuru

Solitary 8 10 3 6 8 20 Calamus sp. 13 Tohiti asli Solitary 166 166 1 4 16 21 Calamus sp. 14 Uban Solitary 148 148 1 3 28 22 Calamus sp. 15 Datuk Clustering 76 196 1 4 20 23 Calamus sp. 16 Kalaka––Mpowaloa––Pait

Solitary 623 623 4 12 54 24 Calamus sp. 17 Nkaruku Solitary 49 49 2 6 19 25 Calamus sp. 18 Ronti Clustering 1 1 1 1 1 26 Calamus sp. 19 Ruru Clustering 2 2 1 2 2 27 Calamus sp. 20 Nona Solitary 2 2 1 2 2 28 Calamus sp. 21 Noko II Solitary 261 261 2 6 28 29 Calamus sp. 22 Putih––Hilako Solitary 245 245 2 4 26 30 Calamus sp. 23 Paloe Solitary 34 34 1 2 8 31 Calamus sp. 24 Uwe koi Clustering 102 122 1 3 15 32 Daemonorops Sitaxentan macroptera Noko Clustering 380 1710 5 25 167 33 Daemonorops sp. 1 Noko ibo Solitary 297 297 3 15 70 34 Korthalsia celebica Tahik manuk Clustering 44 170 3 7 27 Table 5 Observed species richness and estimated species richness after Chao (1987) for all 50 plots Transect Elevation (m) No. of species Chao 1 No of. species/Chao 1 (%) Chao 2 No of. species/Chao 2 (%) 1 250 2 2 100 2 100 2 260 1 1 100 1 100 3 300 2 2 100 2 100 4 340 1 1 100 1 100 5 580 6 8 75 8 75 6 715 4 4 100 4 100 7 725 7 7 100 7 100 8 785 5 5 100 5 100 9 810 7 7 100 7 100 10 860 6 8 75 6.3 96 11 890 14 16.3 86 18.5 76 12 910 6 6 100 6 100 13 920 8 8.5 94 8 100 14 925 7 7.5 93 7 100 15 930 10 10 100 10 100 16 955 10 12 83 10 100 17 965 6 6 100 6 100 18 975 5 5 100 5 100 19 980 7 8 88 7.5 93 20 1010 10 10 100 10 100 21 1020 11 13.3 83 11.3 98 22 1025 10 12 83 10 100 23 1030 11 11 100 11 100 24 1030 7 7.

There was no evidence to suggest a dose–response relationship for

There was no evidence to suggest a dose–response relationship for the risk of hip/femur fracture with TCA use. Table 4 Current use of SSRIs and TCAs and the risk of hip/femur fracture by average daily dose Average daily dose (DDD) Cases Controls Crude OR 95% CI Adjusted ORc 95% CI Current SSRI usea  One prescription before the index date 16 30 2.15 1.17–3.96 1.72 0.92–3.21  Low (<0.5) 22 47 1.88 1.13–3.13 1.50 0.89–2.53  Medium (0.5–1.0) 77 95 3.40 2.51–4.62 2.77 2.03–3.80  High (>1.0) 85 115 3.08 2.31–4.09 BAY 57-1293 clinical trial 2.49 1.86–3.34 Current TCA useb  One prescription before the index date 12

21 2.39 1.17–4.86 1.95 0.94–4.06  Low (<0.5) 95 186 2.13 1.66–2.74 1.73 1.33–2.24  Medium (0.5–1.0) 53 91 2.41 1.71–3.38 1.82 1.28–2.58  High (>1.0) 12 25 1.99 1.00–3.97 1.35 0.66–2.79 aReferent: never exposed to SSRIs bReferent: never exposed to TCAs cAdjustments were made for the confounders listed in the footnote of Table 3 Table 5 presents the results of analyses amongst all anti-depressant users, where current

users were grouped according to the degree of 5-HTT inhibition afforded by the different drugs. The risk of hip/femur fracture increased as the degree of 5-HTT inhibition increased from ORadj 1.64 [95% CI Doxorubicin datasheet 1.14–2.35] for drugs with low 5-HTT inhibition to ORadj 2.31 [95% CI 1.94–2.76] for those with high 5-HTT inhibiting properties. Users of anti-depressants with stronger anti-cholinergic properties, or a strong potential to induce orthostatic hypotension, did not have higher risks of hip fracture compared to users of anti-depressants with weaker properties (data not shown). Table 5 Risk of hip/femur fracture by degree of serotonin (5-HT) transporter inhibition   Cases Reverse transcriptase (n = 6,763) Controls

(n = 26,341) Adjusted ORa 95% CI Never exposed 5,677 23,698 Referent – Past use (>90 days before the index date) 506 1,514 1.19 1.76–2.29 Recent use (31–90 days before the index date) 158 404 1.32 1.09–1.61 Current use (1–30 days before the index date) 422 725 2.01 1.76–1.29  Low 5-HT transporter inhibition 46 102 1.64 1.14–2.35  Medium 5-HT transporter inhibition 132 241 1.92 1.53–2.40  High 5-HT transporter inhibition 234 358 2.31 1.94–2.76  Not classified 10 24 1.44 0.67–3.04 aAdjustments were made for the confounders listed in the footnote of Table 3 Discussion This study has demonstrated an increased risk hip/femur fracture for current users of SSRIs and TCAs. For both SSRIs and TCAs, the increased risk declined rapidly about 6 months after discontinuation of use. Fracture risk associated with SSRIs and TCAs was the greatest during the first few months of use and an elevated risk persisted with continuous use of SSRIs. We found some evidence for a dose effect with SSRIs but not TCAs.